Padroniacindego Padroniacindego

Science

Answered

Give the complementary strand of mRNA

TACAGTGACCTAGGACTAATT

Sagot :

Decastrosteffanygo Decastrosteffanygo

Answer:

Pa brainliest o follow nalang pleaseeeeeee

View image Decastrosteffany

Answer Link

Go Training: Other Questions

Is President Duterte A Populist Or Elite President?

State The Domain Of The Following Relation {(2,-3),(4,6),(3,-1),(6,6),(2,3)}

What Would Our World Would Be If All Persons Use Their Gifts Of Intellect And Free Will With Purpose And Limitations?

This Are The Numbers Consisting Of The Set Of Natural Or Counting Number And Zero?A. Whole NumbersB.positive IntegersC.negative IntegersD.counting Numbers

List One Statement For Scope And Limitations

If You Were An Artist What Kind Qould You Be?

How Are You Going To Answer This Questionwhere Are You From? Do Your Roots Reveal Something About Yourself? 

How Was Magdalene's Faith Tested, And How Did She Respond To It?

What About This Two What Figures Of Subject Are These?8. He Loves To Tickle The Ivories. 9. Fate Frowned On His Endeavors.

Give 3 Example Of Function In Real Life Situation

L(a) = 4a+2 m(a) = A^2 + 2a Find (l/m)(a)

A Mentally-healthy Person Is Perfect. True Or False