RavenSeago RavenSeago

Biology

Answered

The sequence of DNA is 5’ ATGCATAGATTAGGATATCCCAGATAG 3’. What is the sequence of the complimentary RNA strand?

(Pa help po dito please pasahan napo kasi mamaya)

Sagot :

Cailecgo Cailecgo

Answer:

[tex]\red{ \rule{500pt}{100000pt}}[/tex]

Answer Link

Go Training: Other Questions

Give The Effects Of Drugs Use And Abuse On The Community

Isang Tao Na Mga Nakakita Kay Jesus At Ibinigay Niya Kay Hupa

4.wiey Are Not Yet ValceAll The Following Words Can Be Used To Refer To 'older People' EXCEPT?a.Vulnerablec. Proneb. Atsiskd. Immune

1. What Idea Is Presented In The Pictures? 2. How Do You Relate The Pictures To Issues And Concerns On Social Contex? 

Help Me Plssssssssss

2. Ang Asembleya Ng Pilipinas Ang Nagkaloob Ng Karapatan Sa Mga Pilipino Atnagsilbing Batas Organiko Ng Pilipinas. Tama O Mali

15 Workers Can Finish A Job In 100 Days. The Job Needs To Be Finished In 60 Days. How Many Workers Are Needed For The Job To Be Finished In 60 Days. Answer Usin

Himpilang Pandagat At Panghimpapawid Ng America Sa Hawaii

Case Analysis How Will You Help The Case? From The Given Sitution Below, Your Yask Is To Expalin Clearly And Concisely Which Social Science Idea/s Is/are Applic

What Part Of The Body Is Common To All Animals Living On Land?

Sana May Mag Sagot Thnks

Increasing Muscle Temperature Helps Make The Muscles Loose Supple And Pliable