Melissacanete0601go Melissacanete0601go

Health

Answered

What is the meaning of the following:
Abbrasion and Battering
Guys if want to answer my question please in
tagalog language. advance thank you to all

Sagot :

Lbartego Lbartego

Answer:

abbrasion- pagkagalos

battering- pambubugbog

Explanation:

makatulong yan

Answer Link

Go Training: Other Questions

Does A Python List Need To Be Homogeneous(contains Similar Items)? Why Or Why Not?

2. Explain What Is Happening To The Particles Of Water In Ice As It Turns Toliquid.

23 21 28. 29. 23 Ssna Mkatulong Ksyo 

HELP PO PLZZNEED NA PO

Give The Important Steps In Conducting First Aid By Giving Your Own Meaning Of The Acronym AID.A- L-D-pa Help Naman Po Pleaseyung True Answer Sana. 

Alin Sa Sumusunod Ang Binubigyang-pokus Ng Pandiwa Sa Pangungusap?A. PandiwaB. Panlapi Ng PandiwaC. Pananda Ng PaksaD. Paksa Ng Pangungusap

KAISIPAN KUWENTO KUWENTONG-BAYA LAMAT 1. Kuwentong Tumatalakay Sa Pinagmulan Ng Isang Bagay, Pook O Pangyaya 2. Pinakahuling Bahagi Ng Kuwento Na Kung Saan Naka

18. A Triangle With One Obtuse Angle.A. Acute Triangle B. Right Triangle C. Equilateral Triangle D. Obtuse Triangle19. A Quadrilateral With Two Pairs Of Opposit

The Sequence Of DNA Is 5’ ATGCATAGATTAGGATATCCCAGATAG 3’. What Is The Sequence Of The Complimentary RNA Strand?(Pa Help Po, Ty In Advance)

How Can A Researcher Ensure Uniformity And Anonymity When Transcribing Interview Data?A Researcher Must ______________.A. Input The Interview Questions On The W

Read And Understand The Problem Answer The Following Question Below Rex Bought A Trapezoidal Mirror With Each Side Measuring 25cm 10cm 25cm And 35cm Respectivel

Which One Is NOT An Element Used On Digital Design? a. Color b. Direction c. Lines d. Texture Enjoy Libre Yan