Jomarianagrandego Jomarianagrandego

Edukasyon sa Pagpapakatao

Answered

How are the diamond field workers in Zimbabwe being treated?

Sagot :

Alexandermontego Alexandermontego

Answer:

To the Government of Zimbabwe

Immediately end all human rights abuses in the Marange diamond fields, including killings, beatings, forced labor, child labor, and torture.

Explanation:

PA BRAINLIEST ANSWER ❣️❣️

Answer Link

Go Training: Other Questions

Directions: Think Of A Text, A Production, Or A Performance That You Have Read Or Watched. Then, Write A Critique About It Using One Of The Critical Approaches.

The Sequence Of DNA Is 5’ ATGCATAGATTAGGATATCCCAGATAG 3’. What Is The Sequence Of The Complimentary RNA Strand?(Pa Help Po Dito Please Pasahan Napo Kasi Mamaya)

What Is Pandanggo Sa Bangko??

Ano Ang Sining Na Pagtatanghal ,pasagot Po Pls

Which Of The Following Is Not A Mechanical Wave? a. Transverse Waves b. Surface Waves c. Longitudinal Waves d. Electromagnetic Waves pls Answer, I Need It Rn. T

TRUE OR FALSE1. It Is Easy For Higher Ups To Reach Out Those Persons Living In Poverty Line.2. Whatever We Did For One Of Our Least Brothers , We Also Do To Go

Directions: Identify If The Conjunction Used In The Sentence Is (coordinating, Subordinating, Or Correlative). Write Your Answers On The Space Provided. 1. Floo

Ipaliwanag Kung Paano Nabuwag Ang Piyudalismo. Nakabuti Ba Ito Sa Lipunan?

Pagtulong Sa Mga Estranghero Oo O Hindi Paliwanag 

Tamang Sagot Po Kaylangan Ko Ngayon

Why Is It Important To Combat The Covid 19 Pandemic?nonsense Answer = Report

THE DAILY ROUTINE AND LEARNING STYLES OF STUDENT-GAMERS 1. Why You Chose This Particular Topic Or What Your Inspiration Behind This Study Was?2.What Are The Pos